Journal Home
Search for

Volume 45, Issue 3, Pages 196-199 (July 2009)


View previous. 8 of 25 View next.

Development of a real-time RT-PCR for the detection of Swine-lineage Influenza A (H1N1) virus infections

Michael J. Carra, Rory Gunsonb, Alasdair Macleanb, Suzie Coughlana, Margaret Fitzgeraldc, Mary Scullyc, Brian O’Herlihyc, John Ryand, Darina O’Flanagane, Jeff Connella, William F. Carmanb, William W. HallafgCorresponding Author Informationemail address

Received 30 May 2009; accepted 2 June 2009. published online 22 June 2009.

Abstract 

Background

A novel influenza A virus, subtype H1N1 of swine-lineage (H1N1 swl) has transmitted rapidly to many regions of the world with evidence of sustained transmission within some countries. Rapid detection and differentiation from seasonal influenza is essential to instigate appropriate patient and public health management and for disease surveillance.

Objectives

To develop a rapid and sensitive real-time reverse transcriptase polymerase chain reaction (rtRT-PCR) for confirmation of H1N1 swl.

Study design

A one-step rtRT-PCR approach was employed to target the matrix gene of the novel influenza A/H1N1 swl and validated against a panel of seasonal influenza A (H1N1 and H3N2), swine influenza A/H1N1 and avian influenza A/H5N1 viruses. The assay following validation was then used prospectively to detect H1N1 swl positive specimens from the recent outbreaks in the UK and the Republic of Ireland.

Results

The one-step H1N1 swl matrix rtRT-PCR successfully detected H1N1 swl clinical specimens and did not cross-react with seasonal influenza A, subtypes H1N1 and H3N2 viruses and swine influenza A (H1N1). The H1N1 swl matrix assay did cross react with H5N1. The H1N1 swl matrix assay was then compared to two other assays using a dilution series and a panel of untyped influenza A positive clinical samples. These experiments found the assay to have a comparable sensitivity to the established universal influenza A rtRT-PCR and was more sensitive than the H1N1 swl specific assay that targeted the H1 region.

Conclusions

The results demonstrate that the rtRT-PCR is sensitive and should be used alongside existing universal influenza A assays to rapidly detect the novel H1N1 swl virus.

Article Outline

Abstract

1. Background

2. Objectives

3. Study design

4. Results

5. Discussion

Conflicts of interest

Acknowledgment

References

Copyright

1. Background 

return to Article Outline

On April 15th and 17th 2009, a novel swine-lineage influenza A (H1N1 swl) infection was reported to the World Health Organisation (WHO) by the Centers for Disease Control and Prevention (CDC) in Atlanta in two children presenting with febrile respiratory illness from adjacent counties in southern California.1, 2 These cases were not epidemiologically linked and neither child had exposure to swine.2 Subsequent phylogenetic characterisation of H1N1 swl from the U.S. index case (A/California/04/2009) showed that the virus had a unique genome composition that had not been previously identified. Six genes (PB2, PB1, PA, HA, NP and NS) were similar to viruses previously identified in triple-reassortant swine influenza viruses in North American pigs.2 The remaining two genes (NA and M) were derived from Eurasian swine influenza viruses and this particular gene constellation has never been previously identified in humans or other reservoirs.2

Since the original identification of H1N1 swl in the U.S. and Mexico, sustained human to human transmission has been seen in other countries raising concerns of a future pandemic.3, 4, 5 The symptoms seen in U.S. and cases outside of Mexico resemble those normally seen in influenza, with fever, cough, sore throat, rhinorrhea, headache and myaglia, however, approximately 25% of patients had vomiting or diarrhea, which is unusually high compared with infections with other strains of influenza.2 The H1N1 swl NA gene segments sequenced to date suggests that the virus is fully susceptible to the neuraminidase inhibitors, oseltamivir and zanamivir; however, M gene sequencing has shown resistance to the adamantanes.6

The emergence of the H1N1 swl virus has ramifications for existing diagnostic and typing PCR methods as the genetic differences mentioned above may result in a failure to detect and/or type this new virus. Most influenza A PCR assays in use in the United Kingdom target conserved regions of the M gene and therefore should detect influenza A from all established subtypes, including the newly emergent H1N1 swl. However, such methods need to be complimented with a rapid typing test to distinguish seasonal influenza A from H1N1 swl.

This article describes the development of an M gene-based H1N1 swl real-time reverse transcriptase polymerase chain reaction (rtRT-PCR) assay that does not cross-react with human seasonal influenza A viruses (subtypes H1N1 and H3N2). We have used this technique to confirm H1N1 swl infection and to identify transmission events of this novel virus.

2. Objectives 

return to Article Outline

To develop a rapid and sensitive rtRT-PCR for confirmation of H1N1 swl. To validate the potential for cross reactvity to seasonal influenza A/H1N1 and H3N2, enzootic swine A/H1N1 and avian A/H5N1. To compare the end point detection limit of the newly developed assay against an established diagnostic assay that detects all influenza A viruses and a recently published H1N1 swl specific typing method. To prospectively test specimens from recent confirmed cases of H1N1 swl in the United Kingdom and the Republic of Ireland and finally to compare the newly developed assay to an H1N1 swl specific typing assay on 52 clinical samples that were influenza A positive but untyped at the time of testing.

3. Study design 

return to Article Outline

The H1N1 swl rtRT-PCR assay was designed to target segment 7 encoding the matrix protein 1 gene using the sequence of A/California/04/2009 (FJ969513) and Primer Express version 3.0 (Applied Biosystems). The chosen primers (see Table 1) amplify an 80-bp amplicon and bioinformatics analysis using BLAST and Clustal alignments showed no significant homology to human gene sequences and numerous mutations present in the homologous M gene region in seasonal influenza A, subtypes H1N1 and H3N2 viruses.

Table 1.

Primer and probes sequences for the generic influenza A and the H1N1 swl rtRT-PCR assays.

Virus target
Target gene
Forward primer
Reverse primer
Probe
Generic Influenza AMatrixAAGACAAGACCAATYCTGTCACCTCTTCTACGYTGCAGTCCYCGCTFAM-TYACGCTCACCGTGCCCAGTG-BHQ
Influenza A H1N1 swlMatrixTGTGCCACTTGTGAACAGATTGCTGATTAGTGGATTGGTGGTAGTAGCHEX-5′ TGATTCACAGCATCGGTCTCACAGACAG 3′-BHQ

The specificity of the assay was assessed retrospectively using a panel of seasonal influenza A, H1N1 and H3N2 samples (n=7) and swine A/H1N1 and avian A/H5N1 viruses were also included in the panel. A pool containing the following commonly encountered respiratory pathogens was also tested: influenza B, influenza C, parainfluenza 1–4, human metapneumovirus, respiratory syncytial virus, Mycoplasma pneumoniae, rhinovirus and coronaviruses 229E, OC43 and NL63.

The end-point detection limit of the new H1N1 swl rtRT-PCR was directly compared to a widely used universal influenza A rtRT-PCR assay and a H1N1 swl H1 specific rtRT-PCR using a dilution series of a H1N1 swl clinical sample. The universal influenza A rtRT-PCR assay targets the matrix region of the virus and is in use as the frontline diagnostic test for influenza A virus detection at both Glasgow and Dublin virology laboratories. Participation in various EQA schemes has shown this assay to detect influenza A viruses from humans and animals with high sensitivity. The H1N1 swl H1 specific rtRT-PCR has been implemented by most Health Protection Agency affiliated laboratories in England.7

The H1N1 swl matrix assay was then assessed prospectively from the end of April 2009. In the West of Scotland Specialist Virology Centre the assay was ran alongside the routine influenza A rtRT-PCR and was used to test all samples from suspected cases and contacts of H1N1 swl cases. In Dublin the assay was used to test any samples that were influenza A positive that could not be typed by a influenza A H1 or H3 rtRT-PCR. Any samples tested as H1N1 swl positive using the H1N1 swl assay were then tested by sequencing or submitted to the Health Protection Agency for confirmation purposes.

The final assessment comprised of comparing the H1N1 swl matrix assay with the H1N1 swl H1 specific assay on 52 samples that were influenza A positive using the universal influenza A rtRT-PCR. All samples were sent to the WOSSVC during the first week of June, 2009 and were taken from contacts with confirmed cases of H1N1 swl. All were untyped at the time of testing. Total nucleic acid was extracted from respiratory specimens using QIAamp Viral RNA Mini kit (Qiagen, Crawley, United Kingdom) according to the manufacturer's instructions. The oligonucleotide primers and probe (TIB-MOLBIOL, Berlin, Germany) for the both the H1N1 swl and the universal influenza A rtRT-PCR assays are outlined in Table 1. Both assays used the primers at a final concentration of 400nM and the probe at 200nM in a 15μl or 25μl reaction volume. One-step rtRT-PCR was performed on 6μl or 5μl of RNA extract with the Platinum One-step qRT-PCR kit (Invitrogen) on an ABI Prism 7500 SDS real-time platform (Applied Biosystems). The following thermal profile was used: a single cycle of reverse transcription for 15min at 50°C, 2min at 95°C for reverse transcriptase inactivation and DNA polymerase activation followed by 40 amplification cycles of 15s at 95°C and 34min at 60°C each (annealing-extension step). The H1N1 swl H1 specific rtRT-PCR was carried out as described elsewhere.7 Data acquisition occurred at the annealing step of each cycle and the threshold cycle (Ct) for each sample was calculated by determining the point at which the fluorescence exceeded the threshold limit.

4. Results 

return to Article Outline

The specificity of the H1N1 swl matrix protein 1 gene assay was evaluated using a panel comprising seasonal influenza A (H1N1 and H3N2), avian (H5N1) and swine (H1N1) influenza A viruses (Table 2). No cross-reaction with seasonal influenza A (H1N1 and H3N2), swine influenza A (H1N1) or commonly encountered respiratory pathogens was observed. The H1N1 swl assay did, however, cross-react with avian influenza A (H5N1; ∼Ct 37).

Table 2.

Evaluation of the specificity of the H1N1 swl rtRT-PCR assay.

Influenza A subtype
Influenza A universal
H1N1 swl
H3N228.19Neg
H3N225.00Neg
H3N230.05Neg
H3N228.20Neg
H1N127.18Neg
H1N127.38Neg
H1N131.81Neg
Avian H5N126.4137.02
Swine H1N121.95Neg

In comparison with the universal influenza A assay, the H1N1 swl assay was found to have a slightly lower end-point detection limit detecting the 10−3 dilution in one out of two occasions. The influenza A universal assay detected this 10−3 dilution on both occasions (Table 3). The H1N1 swl H1 specific rtRT-PCR was the least sensitive of the three assays, with an endpoint ∼2 logs less than both the universal and H1N1 swl matrix assay.

Table 3.

Dilution series comparing the end-point detection limit of the H1N1 swl assay to the universal influenza A assay.

Dilution
Influenza A universal
H1N1 swl
Neat sample29.6931.14
10−133.13/33.2533.45/34.22
10−236.34/38.237.18/36.34
10−338.08/37.3Neg/37.31
10−4NegNeg
10−5NegNeg
10−6NegNeg

Since the emergence of H1N1 swl, and up unitll the 28th of May, 499 samples from suspected cases and contacts were tested at the WOSSVC in Glasgow. All samples were tested using both the frontline universal matrix and the H1N1 swl rtRT-PCR assays. In total, 15 cases of influenza A were detected in Scotland by the frontline assay in use at the WOSSVC. Of these, 4 were subtyped as seasonal H3 (and were negative by the H1N1 swl assay). Eleven were found to be positive by the H1N1 swl assay (Table 4) and could not be typed using the seasonal H1 and H3 subtyping rtPCR assays. All 11 were subsequently confirmed as H1N1 swl positive by the Health Protection Agency.

Table 4.

Influenza A PCR positive samples detected since the emergence of H1N1swl.

Sample
Universal Flu Ct
H1N1 swl Ct
H1/H3 Typing assay
131.58Neg33.59 (H3)
227.5Neg31.24 (H3)
321.24Neg21.92 (H3)
433.27Neg31.27 (H3)
532.0130.87Neg
632.5735.47Neg
730.929.15Neg
823.2823.22Neg
927.6428.63Neg
1027.427.8Neg
1128.728.7Neg
1237.0938.38Neg
1333.2733.87Neg
1431.7932.62Neg
1530.331Neg
1634.0534.51Neg
1726.2227.30Neg
1820.6818.77Neg

During this same period seven cases of influenza A were detected in Ireland. Of these, four were subtyped as seasonal influenza A (3 subtype H3 and 1 subtype H1) whereas three were untypeable. Using the new assay these were found to be H1N1 swl positive and also had a broad range of viral loads as evidenced by the Ct range (samples 16–18 in Table 4; Genbank accession numbers: GQ169710 and GQ214167). The final comparison assessed both the H1N1 swl matrix assay and the H1N1 swl H1 specific assay on 52 clinical samples tested positive for influenza A using the universal matrix test (Table 5). All samples were submitted to the WOSSVC during the first week of June, 2009. Of these, all 52 typed as being H1N1 swl using the matrix assay. In total, 6 of the 52 samples failed to be detected by the H1N1 swl H1 specific assay. All of these samples had Ct values >35 in the universal influenza and the H1N1 swl matrix assays.

Table 5.

Comparison of the H1N1 swl matrix assay and the H1N1 swl H1 assay on 52 influenza A (untyped) positive clinical samples.

Number of samples
Universal Flu
H1N1 swl matrix
H1N1 swl H1
46+++
6++*
*

All the samples missed by the HPA assay had Ct values >35 in the universal influenza and the H1N1 swl matrix assays.

5. Discussion 

return to Article Outline

Major uncertainties still exist with regards to the transmissibility and virulence of H1N1 swl which warrants the development of new methodologies to detect this virus. Established typing methods such as nucleotide sequencing are sensitive and informative but too prolonged to influence infection control and public health procedures. This article describes the development of a rapid and sensitive rtRT-PCR assay that detects the emerging H1N1 swl virus.

The H1N1 swl matrix assay did not cross react with seasonal influenza A strains currently circulating (subtypes H1N1 and H3N2), swine influenza A (H1N1) or other commonly encountered respiratory pathogens. However, we did observe that the H1N1 swl matrix test detected influenza A, subtype H5N1 which probably due to avian ancestry of the Eurasian M gene in H1N1 swl. Other studies have also highlighted its non-specificity in relation to avian strains of influenza A7. However, since avian influenza A viruses are not circulating in humans in the UK at present the non-specificity of this assay should not pose a particular problem for its routine use and any samples that have a high risk of being avian influenza positive should also be tested using a H5N1 real-time assay in order to rule out this virus. The sensitivity of the H1N1 swl matrix assay is comparable to the frontline universal influenza A rtRT-PCR test in routine use at both Dublin and Glasgow. When testing the dilution series of a clinical sample, both these assays were found to be ∼2 logs more sensitive than the H1N1 swl H1 specific rtRT-PCR assay. The lower sensitivity of the H1N1 swl H1 specific assay was confirmed when it was compared to the H1N1 swl matrix assay on the 52 untyped influenza A positive clinical samples. Based on the results shown here, both the universal and the H1N1 swl matrix assay are sensitive assays that are of great use in the detection and typing of H1N1 swl. After implementation the assay was used to detect 14 cases of H1N1 swl and all were confirmed as being H1N1 swl by other methods/specialist centres.

The rapidity in which the H1N1 swl diagnostic test was designed and implemented highlights one of the main advantages of in-house molecular diagnostic methods. This enabled both Glasgow and Dublin to implement the assay within days of the first UK case being detected. Its use greatly enhanced the public health response to the emergence of H1N1 swl in Scotland and the Republic of Ireland as we were able to rapidly screen samples from patients with suspected travel-associated H1N1 swl. As a result those with infection could be identified quickly and public health interventions implemented to minimise the risk of potential spread. The test was also useful for screening the contacts of these cases and played an important role in detecting the transmission of H1N1 swl from either the index cases and from contact to contact.

Conflicts of interest 

return to Article Outline

The authors declare no conflicts of interest.

Acknowledgments 

return to Article Outline

We would like to thank the staff of the West of Scotland Specialist Virology Centre, Glasgow and the National Virus Reference Laboratory, University College Dublin who carried out the influenza testing and subtyping assays.

References 

return to Article Outline

1. 1CDC . Update: infections with a swine-origin influenza A (H1N1) virus—United States and other countries, April 28, 2009. MMWR Morb Mortal Wkly Rep. 2009;58:431–433.

2. 2Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team. Emergence of a Novel Swine-Origin Influenza A (H1N1) virus in humans. N Engl J Med; in press.

3. 3Fraser C, Donnelly CA, Cauchemez S, Hanage WP, Van Kerkhove MD, Hollingsworth TD, et al. Pandemic potential of a strain of influenza A (H1N1): early findings. Science; in press.

4. 4Surveillance Group for New Influenza A(H1N1) . Virus investigation and control in Spain. New influenza A(H1N1) virus infections in Spain, April–May 2009. Euro Surveill. 2009;14:.

5. 5Health Protection Agency , Health Protection Scotland New Influenza A(H1N1) Investigation Teams . Epidemiology of new influenza A(H1N1) in the United Kingdom, April–May 2009. Euro Surveill. 2009;14:.

6. 6CDC . Update: drug susceptibility of swine-origin influenza A (H1N1) viruses, April 2009. MMWR Morb Mortal Wkly Rep. 2009;58:433–435.

7. 7Ellis J, Iturriza M, Allen R, Bermingham A, Brown K, Gray J, Brown D. Evaluation of four real-time PCR assays for detection of influenza A(H1N1)v viruses. Euro Surveill. 2009 Jun 4; 14 (22). pii: 19230.

a National Virus Reference Laboratory, University College Dublin, Dublin 4, Ireland

b West of Scotland Specialist Virology Centre, Gartnavel General Hospital, Glasgow, United Kingdom

c Department of Public Health, Health Services Executive, Dr. Steeven's Hospital, Dublin 8, Ireland

d Emergency Department, St. Vincent's University Hospital, Dublin 4, Ireland

e Health Protection Surveillance Centre, 25-27 Middle Gardiner St., Dublin 1, Ireland

f Microbiology Department, St. Vincent's University Hospital, Dublin 4, Ireland

g Centre for Research in Infectious Diseases, University College Dublin, Dublin 4, Ireland

Corresponding Author InformationCorresponding author at: National Virus Reference Laboratory, University College Dublin, Dublin 4, Ireland. Tel.: +353 1 7161236; fax: +353 1 7161239.

PII: S1386-6532(09)00247-9

doi:10.1016/j.jcv.2009.06.001


View previous. 8 of 25 View next.