Preparing the outbreak assistance laboratory network in the Netherlands for the detection of the influenza virus A(H1N1) variant

1. Background 

Late April 2009, infection of humans with influenza virus A(H1N1)v emerged in Mexico and the USA and was rapidly spread throughout the world by travellers.1, 2, 3, 4 Because of the imminent threat that this virus can cause the next influenza pandemic,5 preparedness plans were activated, including the preparation of laboratories for surge diagnostic capacity in response to large outbreaks of (emerging) respiratory infections.6 The outbreak assistance laboratories (OAL) network consists of the two reference laboratories (RIVM and Erasmus MC) in the WHO recognized Dutch National Influenza Centre (NIC) and nine regional laboratories, and has been equipped since 2006 with standardized protocols for the detection of A(H5N1) avian influenza viruses.7 These protocols are kept up to date by the NIC that also participated in the bi-annual EQAP studies of the WHO for the detection of A(H5N1) virus as part of the WHO accreditation process.8 Based on results in these EQAP studies both reference laboratories are listed as laboratories having the capability for diagnosing patients infected with A(H1N1)v.9 Through the recently established GISAID influenza virus sequence database, A(H1N1)v sequences were rapidly shared.10 In silico analysis confirmed that influenza A virus detection protocols targeting the M-gene provided by the NIC to the OAL should be able to detect A(H1N1)v. Provided protocols for the subtyping of H5, H7 and seasonal H1 and H3 viruses were expected not to cross-react on basis of sequence comparison, thereby offering the ability to diagnose A(H1N1)v by exclusion, i.e. positive in influenza A virus M-gene and negative in all subtyping RT-PCRs. Since a positive A(H1N1)v specific RT-PCR is however required for proper diagnosis, A(H1N1)v specific primers and probes were designed on the basis of initially available sequences. These assays were used successfully to diagnose the first cases.11 During the validation process, CDC Atlanta, USA, released their protocol as part of the WHO Global Influenza Surveillance Programme in which the NIC participates.12 In view of the potential rapid increase of diagnostic need, the CDC protocol accompanied with pre-ordered primers and probes were distributed to the OAL and supplemented with a proficiency panel.

2. Objectives 

To implement the CDC protocol in the OAL and to compare the performance of the CDC protocol against routinely used influenza A virus RT-PCRs.

3. Study design 

3.2. In-house PCR assays 

Primers and probes sequences and detailed protocols of in-house RT-PCRs used for routine molecular diagnosis of influenza virus are available upon request. The two reference laboratories and one OAL laboratory developed A(H1N1)v specific primers and probes (Table 1).

Table 1. In-house A(H1N1)v specific primers and probes sets developed by members of the OAL.

	Name	Target genea	Sequence	RT-PCR chemistryb	Sourcec
	H1-Sw-1304F	H1v	TTTGGACTTACAATGCCG	Two-stepd	RIVM
	H1-Sw-1410R	H1v	TAGCTGGCTTCTTACCT	Two-stepd	RIVM
	H1-Sw-1357P	H1v	GACTACCACGATTCAAATGTGAAGA	Two-stepd	RIVM
	H1swl-sense	H1v	GGCCATTGCCGGTTTCATTG	One-stepe	LUMC
	H1swl-antisense	H1v	TATCCTGACCCCTGCTCATTTTG	One-stepe	LUMC
	H1swl-probe	H1v	ATCCATCTACCATCCCTGTCCACCC	One-stepe	LUMC
	MexFluN1-Fwd	N1v	ACATGTGTGTGCAGGGATAACTG	One-stepf	EMC
	MexFluN1-Rev	N1v	TCCGAAAATCCCACTGCATAT	One-stepf	EMC
	MexFluN1-Probe	N1v	ATCGACCGTGGGTGTCTTTCAACCA	One-stepf	EMC

a H1v: hemagglutinin gene coding for H1 of A(H1N1)v virus; N1v: neuraminidase gene coding for N1 of A(H1N1)v virus. b RT-PCR chemistry used during development and validation. c RIVM: National Institute for Public Health and the Environment; Bilthoven; LUMC: Leiden University Medical Centre, Leiden; EMC: Erasmus Medical Centre, Rotterdam. d Promega AMV RT for copy DNA step and Roche LightCycler Taqman Master Mix for PCR step. e Qiagen One Step RT PCR Kit. f ABI GeneAmp EZ rTth RNA PCR Kit.

3.3. Proficiency panel 

A panel of 10 blinded specimens containing influenza viruses A(H1N1), A(H3N2) and heat-inactivated (45min 70°C) A/Netherlands/602/2009 (H1N1)v, and negative controls was distributed to all laboratories (Table 2). Virus stocks were diluted in transport medium to obtain virus concentrations that can regularly be detected in influenza A virus infected patients. Per panel specimen 900μl was distributed at ambient temperature by courier delivery on the day of panel preparation. CDC primers and probes, a hardcopy of the CDC protocol revision 1 and a positive control were also distributed.

Table 2. Panel composition and expected results.

	Panel specimen number	Virus	Dilution of virus stocka	Expected resultsb
				Influenza A	Swine influenza A	A(H1N1)v	Seasonal human influenza virus subtyping
	1	A/NL/308/2008(H1N1)	1:100	Pos (1:10,000)	Neg	Neg	H1
	2	A/NL/562/2009(H3N2)	1:100	Pos (1:100,000)	Neg	Neg	H3
	3	Transport medium		Neg	Neg	Neg	Neg
	4	A/NL/558/2009(H3N2)	1:100	Pos (1:100,000)	Neg	Neg	H3
	5	A/NL/602/2009(H1N1)v	1:100	Pos (1:100,000)	Pos (1:10,000)	Pos (1:10,000)	Neg
	6	A/NL/158/2008(H1N1)	1:100	Pos (1:10,000)	Neg	Neg	H1
	7	Transport medium		Neg	Neg	Neg	Neg
	8	A/NL/602/2009(H1N1)v	1:1000	Pos (1:10,000)	Pos (1:10,000)	Pos (1:10,000)	Neg
	9	A/NL/470/2009(H3N2)	1:100	Pos (1:10,000)	Neg	Neg	H3
	10	A/NL/095/2008(H1N1)	1:100	Pos (1:100,000)	Neg	Neg	H1

a Dilution in virus transport medium. b Between brackets the maximum dilution of the specimen positive in the M-gene, swine NP-gene and H1v-gene assays according to the CDC protocol revision 1 carried out at the National Institute for Public Health and the Environment.

4. Results 

4.1. Characteristics of methods used 

Routine diagnostic methods are not standardised in The Netherlands, similar to in many other countries. As a consequence, although OAL used the same primers and probe sets, methods differed in the use of equipment, kits and the amount of RNA or cDNA that was added to the (RT)-PCR mix (Fig. 1).

View Large Image Download to PowerPoint

Fig. 1. Protocols (N=14) used for influenza virus molecular detection in 11 outbreak assistance laboratories involved in preparing for surge diagnostic capacity for respiratory disease outbreaks. Flow diagram shows the variations in RNA extraction platforms, cDNA synthesis, PCR chemistry and amplification platforms, and amount of cDNA or RNA input into the PCR reaction. Weight of the lines reflects the number of laboratories using a particular step. Closed circles indicate steps that were shown to be critical, and dotted lines show steps for which no significant differences were observed in assay performance. Results of RT-PCR are expressed in the table for each of the specimens in the panel for the different targets used and split in one-step or two-step RT-PCR format, by showing the average Ct and standard deviation (SD) for the one-step M-gene based protocol using CDC primers and probe as the “gold standard”, and the delta average Ct and SD for all other targets by one- or two-step RT-PCR approach compared to the “gold standard”. Greyed cells indicate a deviation from the expected result.

4.2. Qualitative results 

All OAL were able to detect seasonal viruses and detect and identify A(H1N1)v using CDC primers and probes and in-house influenza A virus assays (Table 3). Assays for subtyping of seasonal human H1 and H3 viruses correctly identified the hemagglutinin subtypes of the seasonal viruses in the panel but, as expected, were unable to subtype A(H1N1)v. The main reason for not having a 100% correct score was having a positive CDC swine-NP assay with seasonal A(H1N1) and A(H3N2) viruses. High Ct values (>37.00) with the undiluted specimen and rapid disappearance of positive signal in the serial dilutions showed that this only happened at high viral load. Similarly, one laboratory found one A(H3N2) containing specimen positive with the CDC H1v assay (Ct value 37.71). One laboratory was not able to detect A(H1N1)v with the CDC H1v assay. This laboratory had one false positive negative control with in-house M-gene assay, whilst the CDC M-gene assay was negative. In-house NS1-gene based assays, designed for detecting seasonal human influenza A virus, as expected, did not detect the A(H1N1)v virus or with drastically reduced sensitivity.

Table 3. Correct score per laboratory for detection and identification of the panel specimens.

	Laboratory	Datasets	Correct score detection and identification using primers and probesa			Remarks
			CDC and in-house routine influenza A virus (Max 40 points)	In-house human subtype (H1 and H3) (Max 20 points)	In-house A(H1N1)v (H1v or N1v) (Max 10 points)
	1	2	39	20	10	CDC NP with A(H1N1) (n=1); Ct 38.30
	2	1	36	NAb	NA	CDC NP with A(H1N1) (n=3) or with A(H3N2) (n=1); Ct >38.00
	3	1	37	NA	10	CDC H1v negative with A(H1N1)v (n=2)
						False positive negative specimen (n=1)
	4	1	35	20	NA	CDC NP with A(H1N1) (n=4); Ct >37.00
						CDC H1v with A(H3N2) (n=1); Ct 37.71
	5	5	40	20	NA
	6	1	37	20	10	CDC NP with A(H1N1) (n=2) or with A(H3N2) (n=1); Ct >40.00
						NS1 human influenza A virus detects A(H1N1)v with reduced sensitivity Ct>34.00
	7	2	40	NA	NA
	8	1	38	NA	NA	NS1 human influenza A virus does not detect A(H1N1)v
	9	2	40	NA	NA
	10	2	40	20	NA
	11	1	40	20	NA

a For each correct result according to the expected results as displayed in Table 1, one point was given; thus, a maximum of 10 points for the 10 panel specimens for each target. For CDC primers and probe sets M (10 points), swine-NP (10 points), H1v (10 points) and influenza A virus detection with in-house primers and probe sets (M or NS1) (10 points), which totals for all correct 40 points. For in-house human seasonal influenza virus H1 and H3 subtyping a maximum of 10 points each, which totals for all correct 20 points. For in-house A(H1N1)v assays a maximum of 10 points for H1v or N1v. b NA=not applicable as not reported.

5. Discussion 

We showed that with the implementation of the CDC protocol the OAL network is prepared for the detection and specific identification of A(H1N1)v virus. However, we identified some issues that should be resolved, i.e. reduced sensitivity of the CDC swine NP and H1v assays in certain circumstances, cross-reactivity of these assays with seasonal influenza viruses and the absence of broad reacting in-house influenza A virus detection assays in laboratories using human influenza A virus specific NS1-gene based assays. The importance of proficiency testing as learning tool for improving sensitivity and specificity of molecular diagnostics in relation to seasonal influenza and avian influenza A(H5N1) has been demonstrated before.8, 13, 14 Therefore, following communication of the first results of the proficiency panel to the OAL network, most laboratories took action to improve the assays using the CDC primers and probes sets in addition to the in-house influenza A virus detection assays. Our comparative evaluation clearly illustrates one of the challenges in implementing (molecular) diagnostics for a new pathogen, namely the lack of standardisation of these techniques among laboratories. In theory, implementing standardised assays has important benefits as the quality of the assay can be assured and kept up to date by the NIC. For that reason the laboratory network in the United Kingdom is obliged to use CE marked kits provided by the NIC according to European law on the use of kits for patient diagnosis.15 Obtaining this will not be straightforward, as standardisation is currently not endorsed by the professional organisation of medical microbiologists in The Netherlands. The standardisation approach, however, also has its downsides: CE marking is a time-consuming process and is not possible during outbreak response situations. Also, in the phase when genetic data of the target pathogen is scarce, some difference in procedures can be valuable, e.g. when a standard test fails due to mutation in the genome at the 3′ end of primer binding sites. Here, we show our approach to obtain this type of data within a very short time frame by networking capacities from laboratories with high level expertise in molecular diagnostics. Our study rapidly identified which steps in the assays are most critical, thereby directing the focus for evaluation of new methods (PCR chemistry, sample input volume, choice of targets). Having sufficient surge capacity to develop a properly validated protocol, implementing and distributing in-house developed assays to OAL therefore may be in the first phase of the pandemic a more appropriate national emergency plan. Based on this study, the NIC is now working on validated assays for the specific detection of A(H1N1)v which fit in the protocols that have been distributed previously to the OAL in response to the threat of A(H5N1) influenza virus. Results with the two-step CDC swine-NP and H1v assays suggest that sensitivity is correlated with the amount of cDNA input in the PCR reaction. However, a reduced sensitivity may also be caused by imperfectly matching primers and probes. The forward CDC swine NP primer and the H1v probe show one mismatch with A(H1N1)v and the reverse H1v primer shows one or two mismatches depending on the virus strain used in in-silico analyses. Whether the PCR results are affected by this depends on the PCR chemistry used, as enzymes differ substantially in mismatch tolerance. This is a strong argument in favour of standardisation of protocols once they have been made available and validated. Nevertheless, the preferred approach for highly specific and sensitive detection is to develop matching primers and probes. We also evaluated performance of routinely used influenza A virus diagnostic RT-PCRs as an indication of the available routine laboratory capacity if the A(H1N1)v virus should spread as a pandemic strain. This confirmed that the M-gene based methods worked well, and that NS1-gene based assays developed to specifically detect seasonal human influenza A viruses were, as expected, not suitable for detection of A(H1N1)v. We strongly recommend running validated M-gene based RT-PCRs in face of the current situation. If other targets continue to be used, care should be taken to properly validate these methods against the A(H1N1)v influenza virus and other zoonotic influenza viruses. In conclusion, by implementing the CDC primers and probes in RT-PCR protocols running at AOL network laboratories the network is now prepared for specific molecular diagnosis of patients suspected for infection with influenza virus A(H1N1)v when the need for surge capacity commences.

Funding 

This study was partially funding by the Ministry of Health, Welfare and Sport in The Netherlands.

Competing interests 

None declared.

Ethical approval 

Not required.