Preparing the outbreak assistance laboratory network in the Netherlands for the detection of the influenza virus A(H1N1) variant
Article Outline
- Abstract
- 1. Background
- 2. Objectives
- 3. Study design
- 4. Results
- 5. Discussion
- Funding
- Competing interests
- Ethical approval
- Acknowledgements
- References
- Copyright
Abstract
Background
Late April 2009, human infection with variant influenza virus A(H1N1)v emerged in the Northern Americas posing a threat that this virus may become the next pandemic influenza virus.
Objectives
To prepare laboratories for surge capacity for molecular diagnosis of patients suspected for A(H1N1)v infection in the Netherlands.
Study design
A panel of 10 blinded specimens containing seasonal A(H1N1) or A(H3N2), or A/Netherlands/602/2009(H1N1)v influenza virus, or negative control was distributed to the outbreak assistance laboratories (OAL) together with influenza virus A (M-gene), swine influenza virus A (NP-gene) and influenza virus A(H1N1)v (H1v-gene) specific primers and probes and protocol (CDC Atlanta, USA). Laboratories were asked to implement and test this protocol.
Results
All OAL were able to detect A(H1N1)v using the CDC M-gene reagents, the majority with similar sensitivity as the in-house M-gene based assays. RT-PCRs used in routine diagnostic setting in the OAL specifically designed to detect H1, H3, or NS1 from seasonal influenza A viruses, did not or at very low level cross-react with A(H1N1)v. The CDC swine NP-gene and H1v-gene RT-PCRs showed somewhat reduced sensitivity compared to the CDC and in-house M-gene RT-PCRs. In contrast, in-house developed A(H1N1)v specific H1v-gene and N1v-gene RT-PCRs showed equal sensitivity to CDC and in-house M-gene RT-PCRs.
Conclusions
The Dutch OAL are prepared for detection and specific identification of A(H1N1)v, although some level of cross-reactivity was observed with seasonal influenza viruses. Additionally, M-gene based generic influenza A virus detection is recommended to be able to detect emerging influenza A viruses in routine settings.
Abbreviations: A(H1N1)v, variant influenza A(H1N1) virus of swine origin, naming according to latest WHO decision, M, gene encoding the influenza virus matrix protein, HA, gene encoding the influenza virus hemagglutinin, NA, gene encoding the influenza virus neuraminidase, Swine NP, gene encoding the swine influenza virus type A specific nucleoprotein, NS1, gene encoding the influenza virus type A non-structural protein 1, H1v, gene encoding the influenza virus A(H1N1)v specific HA, N1v, gene encoding the influenza virus A(H1N1)v specific NA, NIC, National Influenza Centre, PCR, polymerase chain reaction, RT, reverse transcriptase, RT-PCR, reverse transcriptase polymerase chain reaction, Ct value, cycle threshold value is the number of cycles required for the fluorescent signal to cross the threshold, i.e. exceeds the background level, OAL, outbreak assistance laboratories
Keywords: Influenza, Pandemic, A(H1N1)v, Molecular diagnostics, Laboratory network, Proficiency
1. Background
Late April 2009, infection of humans with influenza virus A(H1N1)v emerged in Mexico and the USA and was rapidly spread throughout the world by travellers.1, 2, 3, 4 Because of the imminent threat that this virus can cause the next influenza pandemic,5 preparedness plans were activated, including the preparation of laboratories for surge diagnostic capacity in response to large outbreaks of (emerging) respiratory infections.6 The outbreak assistance laboratories (OAL) network consists of the two reference laboratories (RIVM and Erasmus MC) in the WHO recognized Dutch National Influenza Centre (NIC) and nine regional laboratories, and has been equipped since 2006 with standardized protocols for the detection of A(H5N1) avian influenza viruses.7 These protocols are kept up to date by the NIC that also participated in the bi-annual EQAP studies of the WHO for the detection of A(H5N1) virus as part of the WHO accreditation process.8 Based on results in these EQAP studies both reference laboratories are listed as laboratories having the capability for diagnosing patients infected with A(H1N1)v.9 Through the recently established GISAID influenza virus sequence database, A(H1N1)v sequences were rapidly shared.10 In silico analysis confirmed that influenza A virus detection protocols targeting the M-gene provided by the NIC to the OAL should be able to detect A(H1N1)v. Provided protocols for the subtyping of H5, H7 and seasonal H1 and H3 viruses were expected not to cross-react on basis of sequence comparison, thereby offering the ability to diagnose A(H1N1)v by exclusion, i.e. positive in influenza A virus M-gene and negative in all subtyping RT-PCRs. Since a positive A(H1N1)v specific RT-PCR is however required for proper diagnosis, A(H1N1)v specific primers and probes were designed on the basis of initially available sequences. These assays were used successfully to diagnose the first cases.11 During the validation process, CDC Atlanta, USA, released their protocol as part of the WHO Global Influenza Surveillance Programme in which the NIC participates.12 In view of the potential rapid increase of diagnostic need, the CDC protocol accompanied with pre-ordered primers and probes were distributed to the OAL and supplemented with a proficiency panel.
2. Objectives
To implement the CDC protocol in the OAL and to compare the performance of the CDC protocol against routinely used influenza A virus RT-PCRs.
3. Study design
3.1. Preparation of kits based on CDC protocol
Primers and probes as specified in revision 1 of the CDC protocol were ordered in bulk (BioLegio, Nijmegen, The Netherlands). The primers and probes have specificity for generic detection of influenza A viruses targeting the matrix (M) gene, for generic detection of swine influenza A viruses targeting the nucleoprotein (swine-NP) gene and for specific detection of A(H1N1)v targeting the hemagglutinin gene of A(H1N1)v (H1v).
3.2. In-house PCR assays
Primers and probes sequences and detailed protocols of in-house RT-PCRs used for routine molecular diagnosis of influenza virus are available upon request. The two reference laboratories and one OAL laboratory developed A(H1N1)v specific primers and probes (Table 1).
Table 1. In-house A(H1N1)v specific primers and probes sets developed by members of the OAL.
| Name | Target genea | Sequence | RT-PCR chemistryb | Sourcec |
|---|---|---|---|---|
| H1-Sw-1304F | H1v | TTTGGACTTACAATGCCG | Two-stepd | RIVM |
| H1-Sw-1410R | H1v | TAGCTGGCTTCTTACCT | Two-stepd | RIVM |
| H1-Sw-1357P | H1v | GACTACCACGATTCAAATGTGAAGA | Two-stepd | RIVM |
| H1swl-sense | H1v | GGCCATTGCCGGTTTCATTG | One-stepe | LUMC |
| H1swl-antisense | H1v | TATCCTGACCCCTGCTCATTTTG | One-stepe | LUMC |
| H1swl-probe | H1v | ATCCATCTACCATCCCTGTCCACCC | One-stepe | LUMC |
| MexFluN1-Fwd | N1v | ACATGTGTGTGCAGGGATAACTG | One-stepf | EMC |
| MexFluN1-Rev | N1v | TCCGAAAATCCCACTGCATAT | One-stepf | EMC |
| MexFluN1-Probe | N1v | ATCGACCGTGGGTGTCTTTCAACCA | One-stepf | EMC |
aH1v: hemagglutinin gene coding for H1 of A(H1N1)v virus; N1v: neuraminidase gene coding for N1 of A(H1N1)v virus. |
bRT-PCR chemistry used during development and validation. |
cRIVM: National Institute for Public Health and the Environment; Bilthoven; LUMC: Leiden University Medical Centre, Leiden; EMC: Erasmus Medical Centre, Rotterdam. |
dPromega AMV RT for copy DNA step and Roche LightCycler Taqman Master Mix for PCR step. |
eQiagen One Step RT PCR Kit. |
fABI GeneAmp EZ rTth RNA PCR Kit. |
3.3. Proficiency panel
A panel of 10 blinded specimens containing influenza viruses A(H1N1), A(H3N2) and heat-inactivated (45
min 70
°C) A/Netherlands/602/2009 (H1N1)v, and negative controls was distributed to all laboratories (Table 2). Virus stocks were diluted in transport medium to obtain virus concentrations that can regularly be detected in influenza A virus infected patients. Per panel specimen 900
μl was distributed at ambient temperature by courier delivery on the day of panel preparation. CDC primers and probes, a hardcopy of the CDC protocol revision 1 and a positive control were also distributed.
Table 2. Panel composition and expected results.
| Panel specimen number | Virus | Dilution of virus stocka | Expected resultsb | |||
|---|---|---|---|---|---|---|
| Influenza A | Swine influenza A | A(H1N1)v | Seasonal human influenza virus subtyping | |||
| 1 | A/NL/308/2008(H1N1) | 1:100 | Pos (1:10,000) | Neg | Neg | H1 |
| 2 | A/NL/562/2009(H3N2) | 1:100 | Pos (1:100,000) | Neg | Neg | H3 |
| 3 | Transport medium | Neg | Neg | Neg | Neg | |
| 4 | A/NL/558/2009(H3N2) | 1:100 | Pos (1:100,000) | Neg | Neg | H3 |
| 5 | A/NL/602/2009(H1N1)v | 1:100 | Pos (1:100,000) | Pos (1:10,000) | Pos (1:10,000) | Neg |
| 6 | A/NL/158/2008(H1N1) | 1:100 | Pos (1:10,000) | Neg | Neg | H1 |
| 7 | Transport medium | Neg | Neg | Neg | Neg | |
| 8 | A/NL/602/2009(H1N1)v | 1:1000 | Pos (1:10,000) | Pos (1:10,000) | Pos (1:10,000) | Neg |
| 9 | A/NL/470/2009(H3N2) | 1:100 | Pos (1:10,000) | Neg | Neg | H3 |
| 10 | A/NL/095/2008(H1N1) | 1:100 | Pos (1:100,000) | Neg | Neg | H1 |
aDilution in virus transport medium. |
bBetween brackets the maximum dilution of the specimen positive in the M-gene, swine NP-gene and H1v-gene assays according to the CDC protocol revision 1 carried out at the National Institute for Public Health and the Environment. |
3.4. Requested testing
The laboratories were asked to test 10-fold serial dilutions in RT-PCRs according to the CDC protocol, in influenza A virus RT-PCRs used routinely in the own laboratory and with newly developed A(H1N1)v specific primers and probes, if already available. The laboratories were asked to report the qualitative and quantitative results and details of the methods used.
4. Results
4.1. Characteristics of methods used
Routine diagnostic methods are not standardised in The Netherlands, similar to in many other countries. As a consequence, although OAL used the same primers and probe sets, methods differed in the use of equipment, kits and the amount of RNA or cDNA that was added to the (RT)-PCR mix (Fig. 1).

Fig. 1.
Protocols (N
=
14) used for influenza virus molecular detection in 11 outbreak assistance laboratories involved in preparing for surge diagnostic capacity for respiratory disease outbreaks. Flow diagram shows the variations in RNA extraction platforms, cDNA synthesis, PCR chemistry and amplification platforms, and amount of cDNA or RNA input into the PCR reaction. Weight of the lines reflects the number of laboratories using a particular step. Closed circles indicate steps that were shown to be critical, and dotted lines show steps for which no significant differences were observed in assay performance. Results of RT-PCR are expressed in the table for each of the specimens in the panel for the different targets used and split in one-step or two-step RT-PCR format, by showing the average Ct and standard deviation (SD) for the one-step M-gene based protocol using CDC primers and probe as the “gold standard”, and the delta average Ct and SD for all other targets by one- or two-step RT-PCR approach compared to the “gold standard”. Greyed cells indicate a deviation from the expected result.
4.2. Qualitative results
All OAL were able to detect seasonal viruses and detect and identify A(H1N1)v using CDC primers and probes and in-house influenza A virus assays (Table 3). Assays for subtyping of seasonal human H1 and H3 viruses correctly identified the hemagglutinin subtypes of the seasonal viruses in the panel but, as expected, were unable to subtype A(H1N1)v. The main reason for not having a 100% correct score was having a positive CDC swine-NP assay with seasonal A(H1N1) and A(H3N2) viruses. High Ct values (>37.00) with the undiluted specimen and rapid disappearance of positive signal in the serial dilutions showed that this only happened at high viral load. Similarly, one laboratory found one A(H3N2) containing specimen positive with the CDC H1v assay (Ct value 37.71). One laboratory was not able to detect A(H1N1)v with the CDC H1v assay. This laboratory had one false positive negative control with in-house M-gene assay, whilst the CDC M-gene assay was negative. In-house NS1-gene based assays, designed for detecting seasonal human influenza A virus, as expected, did not detect the A(H1N1)v virus or with drastically reduced sensitivity.
Table 3. Correct score per laboratory for detection and identification of the panel specimens.
| Laboratory | Datasets | Correct score detection and identification using primers and probesa | Remarks | ||
|---|---|---|---|---|---|
| CDC and in-house routine influenza A virus (Max 40 points) | In-house human subtype (H1 and H3) (Max 20 points) | In-house A(H1N1)v (H1v or N1v) (Max 10 points) | |||
| 1 | 2 | 39 | 20 | 10 | CDC NP with A(H1N1) (n |
| 2 | 1 | 36 | NAb | NA | CDC NP with A(H1N1) (n |
| 3 | 1 | 37 | NA | 10 | CDC H1v negative with A(H1N1)v (n |
| False positive negative specimen (n | |||||
| 4 | 1 | 35 | 20 | NA | CDC NP with A(H1N1) (n |
| CDC H1v with A(H3N2) (n | |||||
| 5 | 5 | 40 | 20 | NA | |
| 6 | 1 | 37 | 20 | 10 | CDC NP with A(H1N1) (n |
| NS1 human influenza A virus detects A(H1N1)v with reduced sensitivity Ct | |||||
| 7 | 2 | 40 | NA | NA | |
| 8 | 1 | 38 | NA | NA | NS1 human influenza A virus does not detect A(H1N1)v |
| 9 | 2 | 40 | NA | NA | |
| 10 | 2 | 40 | 20 | NA | |
| 11 | 1 | 40 | 20 | NA | |
aFor each correct result according to the expected results as displayed in Table 1, one point was given; thus, a maximum of 10 points for the 10 panel specimens for each target. For CDC primers and probe sets M (10 points), swine-NP (10 points), H1v (10 points) and influenza A virus detection with in-house primers and probe sets (M or NS1) (10 points), which totals for all correct 40 points. For in-house human seasonal influenza virus H1 and H3 subtyping a maximum of 10 points each, which totals for all correct 20 points. For in-house A(H1N1)v assays a maximum of 10 points for H1v or N1v. |
bNA |
4.3. Quantitative results
Five of seven laboratories using a one-step RT-PCR approach with the pre-ordered CDC primers and probe set followed the CDC protocol unmodified (i.e. using Invitrogen Superscript III Platinum One-Step Quantitative Kit and CDC temperature protocol) except for the amount of RNA added to the reaction mix (ranging from 9.5 to 20
μl). Two laboratories used another one-step RT-PCR kit. All laboratories that used a one-step approach detected A(H1N1)v and the seasonal viruses using the CDC M-gene assay with similar Ct values (SD range: 0.98–2.33) (Fig. 1). Similarly, these laboratories detected A(H1N1)v using the CDC swine-NP and H1v assays with similar Ct values (SD range: 2.69–2.88 and 1.88–2.04 respectively), although Ct values were slightly higher than with the “gold standard” one-step CDC M-gene assay (Fig. 1). Two laboratories using an in-house one-step M-gene assay reported similar Ct values as the laboratories using the “gold standard” (Fig. 1). The one-step in-house NS1-gene assay used in one laboratory showed slightly higher Ct values compared to the “gold standard” for seasonal influenza viruses, but expectedly had greatly reduced sensitivity for detection of A(H1N1)v. Laboratories using a two-step approach with CDC primers and probes detected seasonal viruses and A(H1N1)v with overall slightly higher Ct values compared to laboratories using the “gold standard” (Fig. 1). Ct values of the two-step CDC swine-NP and H1v assays were considerably higher compared to those with one-step or two-step CDC M-gene assays (Fig. 1). Two-step in-house M-gene assays used by eight laboratories showed a slightly higher Ct value with seasonal viruses and A(H1N1)v compared to those with the “gold standard”, and were more variable (SD range: 2.32–3.86) (Fig. 1). Again, the two-step in-house NS1-gene RT-PCR had considerably higher Ct values with the seasonal influenza A viruses compared to one-step and two-step CDC M-gene assays (Fig. 1). A correlation was found between increasing specimen volume equivalent cDNA input and increasing sensitivity in swine-NP (R2
=
0.8890) and H1v (R2
=
0.8905) two-step CDC assays, but not for the M-gene (R2
=
0.2452) two-step CDC assays with A(H1N1)v.
4.4. Comparison CDC and in-house A(H1N1)v specific assays
Ct values of the in-house developed H1v and N1v assays with A(H1N1)v were similar to those of one-step and two-step CDC M-gene assays (not shown). None of these in-house A(H1N1)v specific assays showed cross-reactivity with the specimens containing seasonal A(H1N1) or A(H3N2) virus (Table 3).
5. Discussion
We showed that with the implementation of the CDC protocol the OAL network is prepared for the detection and specific identification of A(H1N1)v virus. However, we identified some issues that should be resolved, i.e. reduced sensitivity of the CDC swine NP and H1v assays in certain circumstances, cross-reactivity of these assays with seasonal influenza viruses and the absence of broad reacting in-house influenza A virus detection assays in laboratories using human influenza A virus specific NS1-gene based assays. The importance of proficiency testing as learning tool for improving sensitivity and specificity of molecular diagnostics in relation to seasonal influenza and avian influenza A(H5N1) has been demonstrated before.8, 13, 14 Therefore, following communication of the first results of the proficiency panel to the OAL network, most laboratories took action to improve the assays using the CDC primers and probes sets in addition to the in-house influenza A virus detection assays. Our comparative evaluation clearly illustrates one of the challenges in implementing (molecular) diagnostics for a new pathogen, namely the lack of standardisation of these techniques among laboratories. In theory, implementing standardised assays has important benefits as the quality of the assay can be assured and kept up to date by the NIC. For that reason the laboratory network in the United Kingdom is obliged to use CE marked kits provided by the NIC according to European law on the use of kits for patient diagnosis.15 Obtaining this will not be straightforward, as standardisation is currently not endorsed by the professional organisation of medical microbiologists in The Netherlands. The standardisation approach, however, also has its downsides: CE marking is a time-consuming process and is not possible during outbreak response situations. Also, in the phase when genetic data of the target pathogen is scarce, some difference in procedures can be valuable, e.g. when a standard test fails due to mutation in the genome at the 3′ end of primer binding sites. Here, we show our approach to obtain this type of data within a very short time frame by networking capacities from laboratories with high level expertise in molecular diagnostics. Our study rapidly identified which steps in the assays are most critical, thereby directing the focus for evaluation of new methods (PCR chemistry, sample input volume, choice of targets). Having sufficient surge capacity to develop a properly validated protocol, implementing and distributing in-house developed assays to OAL therefore may be in the first phase of the pandemic a more appropriate national emergency plan. Based on this study, the NIC is now working on validated assays for the specific detection of A(H1N1)v which fit in the protocols that have been distributed previously to the OAL in response to the threat of A(H5N1) influenza virus. Results with the two-step CDC swine-NP and H1v assays suggest that sensitivity is correlated with the amount of cDNA input in the PCR reaction. However, a reduced sensitivity may also be caused by imperfectly matching primers and probes. The forward CDC swine NP primer and the H1v probe show one mismatch with A(H1N1)v and the reverse H1v primer shows one or two mismatches depending on the virus strain used in in-silico analyses. Whether the PCR results are affected by this depends on the PCR chemistry used, as enzymes differ substantially in mismatch tolerance. This is a strong argument in favour of standardisation of protocols once they have been made available and validated. Nevertheless, the preferred approach for highly specific and sensitive detection is to develop matching primers and probes. We also evaluated performance of routinely used influenza A virus diagnostic RT-PCRs as an indication of the available routine laboratory capacity if the A(H1N1)v virus should spread as a pandemic strain. This confirmed that the M-gene based methods worked well, and that NS1-gene based assays developed to specifically detect seasonal human influenza A viruses were, as expected, not suitable for detection of A(H1N1)v. We strongly recommend running validated M-gene based RT-PCRs in face of the current situation. If other targets continue to be used, care should be taken to properly validate these methods against the A(H1N1)v influenza virus and other zoonotic influenza viruses. In conclusion, by implementing the CDC primers and probes in RT-PCR protocols running at AOL network laboratories the network is now prepared for specific molecular diagnosis of patients suspected for infection with influenza virus A(H1N1)v when the need for surge capacity commences.
Funding
This study was partially funding by the Ministry of Health, Welfare and Sport in The Netherlands.
Competing interests
None declared.
Ethical approval
Not required.
Acknowledgements
The authors thank Mariam Bagheri and Ton Marzec for preparing the panels, Harrie van der Avoort for organising the shipment of the panels, Jojanneke Dekkers, Nathalie Bus, Lotte Broers, Caroline de Jong, Ronald Huijsmans, Judith Kuijpers, Tim Schuurman, Lilli Gard, Nellie Nieuwenhuizen, Noortje van Maarseveen, Yvette van Aarle, I.R. Roozeboom and S. Rebers for technical assistance in the OAL network laboratories.
References
- . Swine influenza A (H1N1) infection in two children—Southern California, March–April 2009. MMWR Morb Mortal Wkly Rep. 2009;58:400–402
- . Update: infections with a swine-origin influenza A (H1N1) virus—United States and other countries, April 28, 2009. MMWR Morb Mortal Wkly Rep. 2009;58:431–433
- . Outbreak of swine-origin influenza A (H1N1) virus infection—Mexico, March–April 2009. MMWR Morb Mortal Wkly Rep. 2009;58:467–470
- . Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N Engl J Med. 2009;[May 22; Epub ahead of print]
- The WHO rapid pandemic assessment collaboration. Pandemic potential of a strain of influenza A(H1N1): early findings. Science. 2009;[May 14; Epub ahead of print]
- Strengthening the diagnostic capacity to detect Bio Safety Level 3 organisms in unusual respiratory viral outbreaks. J Clin Virol. 2009;45:185–190
- . Diagnostiek voor influenza A (H5N1) op het RIVM—1 juni 2006. 2009;Available from: http://www.rivm.nl/cib/infectieziekten-A-Z/infectieziekten/aviaire_influenza/publicatie_aviaire_influenza_deel_III.jsp [Accessed 29.5.2009]
- WHO external quality assessment project for the detection of subtype influenza A viruses by polymerase chain reaction—summary analysis, 2007 and 2008. Wkly Epidemiol Rec 2008;83:401–12.
- . Countries able to perform PCR to diagnose influenza A (H1N1) virus infection in humans. 7 May 2009;Available from: http://www.who.int/csr/resources/publications/swineflu/country_pcr_capacity/en/index.html [Accessed 28.5.2009]
- Bogner P, Capua I, Lipman DJ, Cox NJ, and others. A global initiative on sharing avian flu data. Nature 2006;442:981.
- ProMED-mail. Influenza A (H1N1)—worldwide (17). ProMED-mail 2009; 8 May: 20090508.1722; 2009. http://www.promedmail.org [Accessed 29.5.2009].
- . CDC protocol of realtime RTPCR for influenza A(H1N1), 28 April 2009 revision 1 (30 April 2009). 2009;Available from: http://www.who.int/csr/resources/publications/swineflu/CDCRealtimeRTPCR_SwineH1Assay-2009_20090430.pdf [Accessed 28.5.2009]
- . Molecular detection and typing of influenza viruses: are we ready for an influenza pandemic?. J Clin Virol. 2008;42:194–197
- . Molecular detection and identification of human and avian influenza viruses by European National Influenza Centres: results of two subsequent external quality assessments. In: Programme and Abstract Book Third European Influenza Conference. Vilamoura, Portugal, 14–17 September. 2008;[Abstract 2-004]
- . Establishment of a UK national influenza H5 laboratory network. J Med Microbiol. 2007;56(Pt 10):1263–1267
PII: S1386-6532(09)00249-2
doi:10.1016/j.jcv.2009.06.003
© 2009 Elsevier B.V. All rights reserved.
